Перед настоящей статьей стоит непростая задача – показать историческую связь тысячелетий эволюции человеческого рода под названием «гаплогруппа N», состоящего из двух сотен миллионов человек, с группой представителей княжеских родов Российской империи, имеющих ту же гаплогруппу, и чья официальная родословная восходит к Рюрику и Гедимину; объяснить, что такое «гаплогруппы», а значит, изложить основы ДНК-генеалогии, и всё это увязать с ДНК-идентификацией Рюриковичей. Ясно, что в сколь-нибудь умеренно полном, как и в кратком объеме, решение такой задачи нереально, поэтому будем рассматривать статью только как постановку такой задачи, как введение в материал, приведение немногих, но необходимых сведений, способных вызвать интерес к предмету исследования, к его методологии, к потенциалу новой науки – ДНК-генеалогии, или молекулярной истории.
 

 
Напомним, что результаты ДНК-тестирования мужчин в рамках ДНК-генеалогии сводятся к двум основным показателям. Это – гаплотип и гаплогруппа. Гаплотип – это набор чисел, который является «личным номером ДНК-паспорта» любого мужчины, без исключения. А гаплогруппа, фигурально говоря, это обложка паспорта. Это – не индивидуальная, а групповая характеристика. Гаплогруппа определяет носителя гаплотипа в определенный род, или историческое племя. У любой гаплогруппы, как у любого рода или племени, был один общий предок, патриарх. Поэтому как номер паспорта при наличии обложки является уникальным «определителем» человека, так и гаплотип в совокупности с гаплогруппой являются не менее уникальным определителем человека, при условии, что номер (гаплотип) является достаточно протяженным. Примеры дадим ниже.


 

Поддержите проекты Академии ДНК-генеалогии: ваше пожертвование – это дальнейшее изучение истории наших предков, выпуск тематических книг, организация научных мероприятий, исследование палео-днк и ещё многое другое. У нас пока нет других помощников, кроме вас. Поэтому если вы считаете нашу работу полезной, нужной и можете её поддержать, то будем благодарны. Сделать пожертвование от 100 до 5000 руб. можно буквально в один клик по этой ссылке.

 

Если у человека такого номера и паспорта нет, то это не мужчина, а женщина. Именно к такому выводу сейчас нередко приходят археологи, которые именно так наиболее надежно определяют пол скелетного остатка в древнем захоронении. Нет Y-хромосомы, нет мужского гаплотипа и мужской гаплогруппы – значит, женщина. У последних – свой ДНК-паспорт, под названием «митохондриальная ДНК», который они передают своим детям, как девочкам, так и мальчикам. А отец передает исключительно Y-хромосому, и только, разумеется, сыновьям.
 
Поэтому у каждого мужчины в Y-хромосоме своя картина мутаций. У близких родственников картина мутаций похожа, потому что они, родственники, сравнительно недавно произошли от одного общего предка, и дополнительные мутации в их Y-хромосомах еще не успели образоваться. Если общий предок жил тысячелетия назад, то картина мутаций у потомков разная. Как эту картину отображают?
 
Отображают картину мутаций в виде так называемых гаплотипов, упомянутых выше как «личный номер паспорта» каждого мужчины, а именно в виде определенных последовательностей чисел, характерных для каждого человека. Чем эта последовательность длиннее, тем уникальнее гаплотип. Например, у автора этих строк гаплотип Y-хромосомы, состоящий из 111 чисел, записывается в следующем виде:
 
13 24 16 11 11 15 12 12 10 13 11 17 – 16 9 10 11 11 24 14 20 34 15 15 16 16 – 11 11 19 23 15 16 17 21 36 41 12 11 – 11 9 17 17 8 11 10 8 10 10 12 22 22 15 10 12 12 13 8 15 23 21 12 13 11 13 11 11 12 13 – 31 15 9 15 12 25 27 19 12 12 12 12 10 9 12 11 10 11 12 30 12 14 25 13 9 10 18 15 20 12 24 15 12 15 24 12 23 19 11 15 17 9 11 11
 
Это — так называемый 111-маркерный гаплотип. Здесь первое число показывает, что в одном из маркеров, или локусов Y-хромосомы определенная последовательность нуклеотидов повторяется 13 раз. В другом маркере, который здесь показан как следующий, блок нуклеотидов повторяется 24 раза, и так далее.
 
В академических публикациях по популяционной генетике, впрочем, пока продолжают использовать гаплотипы от 8- до 17-маркерных, и это тот случай, когда «любители» далеко обогнали «профессионалов». Хотя те любители на самом деле зачастую намного квалифицированнее професcионалов, это просто профессионалы называют тех «любителями», чтобы не признавать свое колоссальное отставание и интеллектуальный застой в популяционной генетике. Этот вопрос никак не обойти при изложении основ ДНК-генеалогии.
 
Естественно, чем длиннее гаплотип, тем выше вероятность того, что в нем произойдет мутация. Как уже не раз здесь пояснялось, мутация в гаплотипах – это результат ошибки в копировании блоков нуклеотидов, тех самых «коротких тандемных повторов», биологической системой копирования ДНК в клетке. Каждый нуклеотид мутирует, то есть копирующая системе ошибается при копировании протяженных гаплотипов, со средней вероятностью примерно 0.00178 раз в поколение при протяженнности поколения 25 лет, или раз в 560 поколений, или раз в 14 тысяч лет. Величина поколения в 25 лет в ДНК-генеалогии называется условным поколением, она – сугубо математическая величина. Если кому-то больше нравится брать 30 лет за поколение, то вероятность мутации на 30 лет составит примерно 0.00214, или раз в 468 поколений (по 30 лет), или раз в 14 тысяч лет. Как видим, конечный результат получается точно такой же.
 
Итак, у любого человека можно выявлять гаплотип с разным разрешением, это будет один и тот же «ДНК-генеалогический паспорт», только разрешение, естественно, тем больше, чем более протяженный гаплотип. Надо сказать, что наука не остановилась на 111-маркерном гаплотипе, и, например, у того же автора определен уже 431-маркерный гаплотип:
 
13 24 16 11 11 15 12 12 10 13 11 30 16 9 10 11 11 24 14 20 34 15 15 16 16 11 11 19 23 15 16 17 21 36 41 12 11 11 9 17 17 8 11 10 8 10 10 12 22 22 15 10 12 12 13 8 15 23 21 12 13 11 13 11 11 12 13 – 31 15 9 15 12 25 27 19 12 12 12 12 10 9 12 11 10 11 12 30 12 14 25 13 9 10 18 15 20 12 24 15 12 15 24 12 23 19 11 15 17 9 11 11 – 10 12 15 15 10 10 8 8 9 13 7 8 10 10 13 14 14 15 31 32 11 10 9 9 8 24 8 8 8 16 22 22 24 21 23 14 16 25 28 15 15 6 11 14 15 8 14 11 12 10 11 10 10 11 11 18 10 12 10 7 10 5 8 9 5 5 11 15 8 29 6 7 10 13 11 6 7 7 7 16 10 11 16 22 23 11 12 12 10 7 12 12 13 7 3 20 18 11 11 8 9 13 13 10 11 22 12 16 13 14 11 11 12 10 12 9 13 9 12 11 12 16 7 14 12 10 9 10 4 7 7 13 13 12 11 9 11 10 11 14 8 4 8 6 11 11 16 9 11 13 19 12 12 9 10 9 9 11 11 9 9 14 14 15 9 7 10 12 14 13 14 14 12 6 32 10 11 16 8 7 17 17 11 11 6 13 12 13 11 10 7 13 12 7 – 12 12 7 14 17 17 11 25 8 8 12 8 8 11 13 11 12 10 8 13 8 13 14 10 11 9 20 17 15 36 9 13 14 39 33 36 9 10 10 12 18 19 13 9 14 44 10 8 14 9 8 20 11 11 11 11 10 9 9 9 8 8 8 8 9 11 9 23 11 9 16 31 8 20 8 13 12 8 16 10 9 33 27 23 22 10 8 12 10 8 14 8 8 32 55 7 7 5 9 6 11 11 11 13 9 39 33 7 8 27 7 5 13 7 15 28 25 60 42 12 31 22 20 12 3 4
 
Таких гаплотипов в мире определено пока всего несколько десятков, так что практическая польза от них пока невелика, за исключением нескольких специальных случаев, которые будут пояснены ниже.
 
Поскольку «коротких тандемных повторов» в Y-хросомоме многие тысячи (выше показано 431 таких повторов, и это только среди 10 миллионов нуклеотидов Y-хромосомы, этот размер определяется методологией исследования; всего же в Y-хромосоме примерно 58 миллионов нуклеотидов, или, точнее, нуклеотидных пар, но не будем здесь вдаваться в излишние подробности). Отсюда можно заключить, что таких «тандемных повторов» в Y-хромосоме может быть примерно 2500, и это, видимо, максимально возможный размер гаплотипа.
 
Покажем для сравнения 67-маркерный гаплотип представителя Российского Дворянского собрания Г.Н. Гришина:
 
14 23 14 11 11 13 11 13 12 13 14 17 – 17 9 9 11 12 26 14 19 29 15 15 15 15 – 11 10 18 20 14 15 18 19 36 36 14 10 – 11 8 15 17 8 8 10 8 11 10 12 21 22 14 10 12 12 18 7 13 20 21 15 12 11 10 11 11 12 11
 
И еще один, представителя Российского Дворянского собрания С.В. Думина:
 
14 23 15 11 11 13 11 12 11 13 15 16 – 17 9 9 11 12 25 14 19 27 14 14 15 15 – 11 11 18 20 14 15 16 19 37 37 13 10 – 11 8 15 17 8 8 10 8 11 10 12 21 22 14 10 12 13 18 7 12 22 21 16 12 11 10 11 11 12 11
 
Оба последних значительно отличаются от моего гаплотипа, и на первых 67 маркерах имеют соответственно 72 и 71 мутации по сравнению с моим, но между собой эти два гаплотипа различаются всего на 19 мутаций. Почему такая разница?
 


Г.Н. Гришин и С.В. Думин

Чтобы ответить на этот вопрос, перейдем к понятию гаплогруппы. У меня «обложка паспорта» другая, я принадлежу к другому роду – роду R, и далее к его подгруппе, или субкладу R1a. Г.Н. Гришин и С.В. Думин относятся к роду N, субкладу N1c1. Род R образовался не менее 30 тысяч лет назад, род N – примерно 20 тысяч лет назад, но они образовались независимо друг от друга, и происходят от общего предка в гаплогруппе К (см. ниже), поэтому между нашими родами не менее 50 тысяч лет. За это время и накопились более 70 мутаций между нашими гаплотипами. А два последних гаплотипа образовались в пределах не только рода (гаплогруппы) N, и не только в пределах одного субклада (племени) N1c1, но даже в пределах нижестоящего субклада N1c1a1a-L1026 (ниже объяснено, что это такое, и показана ДНК-генеалогическая диаграмма), которому не более 4000 лет. Это означает, что у отца из рода N1c1a1 родился сын, в Y-хромосоме которого образовалась новая мутация, которую генетики намного позже назвали L1026, и все потомки этого мальчика, которых сейчас миллионы, в своих Y-хромосомах несут эту мутацию. Иначе говоря, тот мальчик стал патриархом субклада N1c1a1a-L1026, и среди его многочисленных потомков – Г.Н. Гришин и С.В. Думин. Их гаплотипы отстоят друг от друга на 19/0.12 = 158 → 187 условных поколений (по 25 лет в поколении), или примерно на 4675 лет, значит, их общий предок жил половину этой дистанции, или примерно 2350 лет назад, во второй половине I тыс. до н.э. Здесь 19 – число мутаций между их 67-маркерными гаплотипами, стрелка показывает поправку на возвратные мутации (поскольку мутации происходят в обоих направлениях, то есть часть мутаций возвращается в исходное положение), 0.12 – константа скорости мутации в 67-маркерных гаплотипах.
 
2350 лет назад, когда жил общий предок Г.Н. Гришина и С.В. Думина, соответствует времени, когда носители гаплогруппы N уже прибыли в Прибалтику двумя миграционными потоками; один, более древний, расселился, начиная с 2500 лет назад на Южной Балтике, другой, более недавний, расселился на 500 лет позже на территории нынешней Финляндии. Их потомки имеют довольно четкое различие в гаплотипах: первые (в итоге они стали в основном южно-балтийскими славянами) имеют характерную «двойную подпись» 9 9 и 14 14 15 15 (и ее вариант 15 15 15 15, который происходит в одну мутацию, называемую мультикопийной, при которой пара одинаковых аллелей, как в данном случае 15 15, переписывается в один ход «поверх» 14 14)
 
14 23 14 11 11 13 11 13 12 13 14 17 – 17 9 9 11 12 26 14 19 29 15 15 15 15 – 11 10 18 20 14 15 18 19 36 36 14 10 – 11 8 15 17 8 8 10 8 11 10 12 21 22 14 10 12 12 18 7 13 20 21 15 12 11 10 11 11 12 11 (гаплотип Г.Н. Гришина)
 
14 23 15 11 11 13 11 12 11 13 15 16 – 17 9 9 11 12 25 14 19 27 14 14 15 15 – 11 11 18 20 14 15 16 19 37 37 13 10 – 11 8 15 17 8 8 10 8 11 10 12 21 22 14 10 12 13 18 7 12 22 21 16 12 11 10 11 11 12 11 (гаплотип С.В. Думина);
 
вторые, ставшие финнами, имеют характерную «подпись» в тех же участках Y-хромосомы 10 10 и 13 13 14 14. Эта стабильная разница и указывает на разных общих предков обоих миграционных потоков – северного и южного.
 
Откуда получают те числа, которые показаны в гаплотипах? Всё это на самом деле четко определено и зафиксировано. В первом маркере (под названием DYS393) повторяется четверка нуклеотидов AGAT, то есть аденин-гуанин-аденин-тимин
 
GTGGTCTTCTACTTGTGTCAATAC/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/
AGAT/AGAT/AGAT/AGAT
/ATGTATGTCTTTTCTATGAGACATACCTCATTTTTTGGACTTGAGTTC,
 
и повторы обрамляются уже неупорядоченными последовательностями нуклеотидов в ДНК, как показано выше. Этот участок в ДНК и есть локус, он же маркер DYS393. Во втором маркере, под названием DYS390, повторяется уже другая четверка – TCTG, то есть тимин-цитозин-тимин-гуанин, которая переходит в четверку TCTA, то есть тимин-цитозин-тимин-аденин, и число повторов складывается:
 
TATATTTTACACATTTTTGGGCCCTGCATTTTGGTACCCCATAATATATTCTATCTA/TCTG/TCTG/TCTG
/TCTG/TCTG/TCTG/TCTG/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA
/TCTG/TCTA/TCTA/TCTA
/TCATCTATCTATCTTTCCTTGTTTCTGAGTATACACATTGCAATGTTTT
CATTTTACTGTCAC.
 
Перечисленные четыре нуклеотида — это язык ДНК, который состоит из четырех букв при сокращенной записи. Эти нуклеотиды комбинируются парами, их так и называют — «пары оснований». Они фактически держат двойную спираль ДНК. Нам эти четверки (а также тройки нуклеотидов, и другие типы повторов) в маркерах ДНК в дальнейшем не понадобятся, это описание мы даем только для того, чтобы показать, что за числами в гаплотипах стоят масштабные исследования, которыми занимаются в мире сотни и тысячи человек.
 
Мы видим, у меня, в гаплогруппе R1a, первый маркер дал 13 повторов, а у моих коллег из гаплогруппы N1c1 там 14 повторов. И вообще, из первых 12 маркеров (их называют «первой панелью маркеров») в семи маркерах число повторов у нас разное, и еще в двух маркерах есть вариации. Это потому, что рода разные, и за 50 тысяч лет они по мутациям разошлись довольно далеко. Взглянем, у каких маркеров числа (под названием «аллели») сохранились. Это по порядку 4-й, 5-й и 10-й, они имеют классификационные наименования DYS391, DYS385a и DYS389a (DYS означает «DNA Y Segment», а номер – системный номер соответствующего участка в Y-хромосоме согласно классификации). Константы скорости мутации в этих участках равны соответственно 0.00265, 0.0013 и 0.008 мутаций в расчете на условное поколение в 25 лет. Иначе говоря, мутации в этих участках (или локусах) происходят раз в 9400, 19200 и 31250 лет, соответственно. За 50 тысяч лет могли бы и мутировать, и не один раз, но в ДНК наблюдаются возвратные мутации, которые происходят с такими же константами скоростей (поскольку ДНК при копировании «не знает», в какую сторону прошла мутация до того), и при возврате мутации аллель приобретает «исходный вид». Поэтому при расчетах необходимо вводить поправки на возвратные мутации.
 
Но единичные мутации не дают хорошей статистики, поэтому желательно рассматривать большие выборки гаплотипов, в сотни, а то и в тысячи гаплотипов. В среднем же 67-маркерный гаплотип мутирует с константой скорости мутации 0.12 за 25 лет, то есть одна мутация в среднем происходит в гаплотипе за 1/0.12 поколений, то есть примерно раз в 8 условных поколений, или раз в 208 лет. С такими протяженными гаплотипами уже удобно работать, они дают неплохое разрешение при расчетах. Именно так было получено, что 19 мутаций между парой гаплотипов выше соответствуют временной дистанции 4675 лет, а общий предок жил половину этой временной дистанции назад. При расчетах была сделана поправка на возвратные мутации, которые происходят на больших отрезках времени, превышающих 25 условных поколений, то есть 625 лет.
 
Теперь понятно, почему гаплотипы выбирают так, чтобы в них таких маркеров было как можно больше (но все-таки чтобы оставаться в рамках практичности), и в ранних работах использовались 6-маркерные гаплотипы, затем 12-маркерные, 17- и 19-маркерные, затем 25- и 37-маркерные, а сейчас работа рутинно ведется с 67- и 111-маркерными гаплотипами (правда, в академических публикациях это обычно от 8 до 17 маркерных гаплотипов). В 111-маркерных гаплотипах одна мутация происходит в среднем за 5 поколений, поэтому у 111-маркерных гаплотипов разрешение лучше других. Но их определять дороже, чем более короткие, поэтому в академических исследованиях, при постоянной нехватке денежных средств, приходится работать с более короткими гаплотипами. Длинные гаплотипы определяют в коммерческих компаниях, обычно персонально, по индивидуальному заказу, и обычно передают в общественные базы данных. Сейчас в общественных базах данных — сотни тысяч гаплотипов, и базы прирастают многими гаплотипами ежедневно.
 
Как мы покажем ниже, эти гаплотипы, а именно числа в них, напрямую связаны с хронологией древних миграций людей, переходами людей на новые места, событиями прошлого — войнами, климатическими катаклизмами, эпидемиями, в общем, со всем тем, что так или иначе влияло на численность популяций человека в определенные времена и на определенных территориях. Например, расчеты могут показать, когда носители гаплогруппы N были на Урале, когда они появились в Прибалтике, когда древние арии появились на Русской равнине, когда они появились в Индии, Иране, на Ближнем Востоке — потому что эти события приводили к появлению на этих территориях и в те времена общих предков популяций, которые разрастались вплоть до нашего времени, образуя «кусты» гаплотипов со всеми мутациями в них, то есть изменениями чисел в маркерах.
 
Обратимся к гаплогруппам, тем самым «обложкам паспорта», групповым характеристикам. Как было сказано, большое число мутаций и, соответственно, большое временное расстояние между гаплотипами гаплогруппы R1a и N1c1 (десятки тысячелетий) вызвано тем, что они относятся к разным родам человека, а относительно умеренное расстояние между двумя гаплотипами одной гаплогруппы (и к тому же одного субклада, N1c1), всего несколько тысяч лет, было вызвано тем, что они фактически родственники, в рамках понятий ДНК-генеалогии. В целом понятия гаплогруппы и субклада часто взаимозаменимы, и определяются контекстом изложения. И гаплогруппы, и субклады определяются необратимыми мутациями в Y-хромосоме, в отличие от обратимых мутаций в гаплотипах (тех самых повторов, что описаны выше, которые в научной литературе называют STR, от Short Tandem Repeats). Эти необратимые мутации, которые называют снип-мутациями (от сокращения SNP, Single Nucleotide Polymorphism), стараются подобрать такие (для идентификации гаплогрупп и субкладов), которые были бы стабильными за все время существования человечества. Поэтому гаплогруппы и субклады стабильны, не меняются во времени.
 
Всего в мире насчитывают 20 основных гаплогрупп, которые обозначают буквами латинского алфавита, от А до Т, хотя систему порой нарушают. В последнее время в классификацию добавили гаплогруппы A0 и A00, хотя их носителей обнаружили считанные единицы, все они живут в Африке. Но они настолько отстоят по снип-мутациям от всех остальных людей на Земле (тестированных на мутации в ДНК), что их пришлось выделить в отдельный род-гаплогруппу. Помимо этого, были идентифицированы промежуточные, сводные гаплогруппы, такие как СТ, DE, GHIJK и другие (см. диаграмму ниже), так что минимальный состав генеалогического дерева мужской половины человечества включает уже 39 основных гаплогрупп, то есть главных уровней Y-хромосомного генеалогической структуры. С подгруппами это составляет уже много сотен.
 
Если же считать все уровни генеалогического дерева (уровень в этом случае – это субклад), то гаплогруппа R1a, основная гаплогруппа (род) этнических русских, насчитывает 66 субкладов, гаплогруппа R1b (основной западно-европейский род) – 289 субкладов, гаплогруппа N – 34 субклада. Разница в числах объясняется не тем, что последняя гаплогруппа более молодая, а тем, что она менее изучена. Она редко встречается в Западной Европе, где наиболее часта гаплогруппа R1b, и потому ей меньше занимаются. Но в последнее время к поиску новых субкладов стали применять геномные методы, при которых анализ генома идет по миллионам снип-мутаций, и число субкладов гаплогруппы N резко увеличилось. Ниже мы покажем текущую диаграмму снип-мутаций гаплогруппы N. Сама же гаплогруппа N образовалась при появлении необратимой мутации в виде спонтанного превращения одного нуклеотида в другой в ДНК (Y-хромосоме) патриарха, или его выжившего потомка, в свою очередь потомки которого дожили до настоящего времени в количестве около двухсот миллионов человек (только в Китае их по оценкам более 140 миллионов, или две трети от всех носителей гаплогруппы N в мире; на втором месте – Россия с 10 миллионами носителей гаплогруппы N, примерно 14% от всего мужского населения страны; на третьем месте – Украина с Белоруссией). У него, патриарха гаплогруппы N, по сравнению с ДНК его отца (относящегося к сводной гаплогруппе NO) при зачатии и первом копировании Y-хромосомы произошло спонтанное превращение нуклеотида гуанина в аденин, и это произошло в участке Y-хромосомы под номером 15 миллионов 469 тысяч 724. С тех пор все носители гаплогруппы N и ее субкладов, то есть прямые потомки того мальчика, ставшего патриархом огромного рода, несут в своих ДНК этот снип, под индексом М231. Всего же в Y-хромосоме мужчин насчитывается, как сообщалось выше, примерно 58 миллионов нуклеотидов.
 
Приведем общее дерево гаплогрупп современного человечества. На нем можно найти гаплогруппу N, и гаплогруппу R с субкладом R1a, и убедиться, что они на самом деле отстоят друг от друга довольно далеко.
 

Перейдем к гаплогруппе N в несколько бóльших деталях.
 

 
Дерево гаплогруппы N показывает динамику ее субкладов за последние 20 тысяч лет. Первыми от дерева отошла южноазиатская ветвь субклада N1a, затем китайские и вьетнамские ветви субклада N1b, и миграцию на север, через алтайский регион, продолжили субклады N1c. Было это примерно 8 тысяч лет назад. Примерно 6 тысяч лет назад образовалась евразийская ветвь N1c1a1-L708, за ней центральная евразийская ветвь L1026, примерно 5 тысяч лет назад. Около 3 тысяч лет назад образовалась южно-балтийская ветвь, к которой принадлежит группа князей Российской империи, датировка общего предка которых согласуется со временем жизни легендарного Рюрика. Об этом речь в деталях пойдет позже, но сейчас важно отметить, что это – южно-балтийская, славянская ветвь, и характерная «подпись» в их гаплотипах опять типичная южно-славянская, как и у Г.Н. Гришина и С.В. Думина, гаплотипы которых приведены выше. В них есть вариации типа 14-15-15-15 (Гагарин), 14-14-14-14 (Пузына), так и 15-15-15-15 (Гришин), но это все продукты одной мутации в мультикопийных маркерах, а одна мутация может пройти в любом поколении у любого человека.
 

В заключение данного раздела приведем еще одну диаграмму субкладов гаплогруппы N, более детальную, дополненную геномными определениями снипов (BigY и YFull):
 

 
Рис. 1. Дерево субкладов гаплогруппы N. Расшифровка цветовой кодировки приведена в правой нижней части диаграммы. ISOGG – International Society of Genetic Genealogy, Big-Y – геномный проект, рассматривающий фрагменты Y-хромосомы общим размером 10 миллионов пар оснований, YFull – геномный проект, рассматривающий фрагменты Y-хромосомы общим размером 30 миллионов пар оснований (вся Y-хромосома – 58 миллионов пар оснований), HGDP – Human Genome Diversity Project. Источник – сетевые данные Jakko Väyrynen и G. Dunkel.
 
Диаграмма субкладов гаплогруппы N выше и рис. 1 показывают, что узловым субкладом, от которого произошло расхождение уральского миграционного потока гаплогруппы N1c1 на южно-балтийское и финское направления, был N1c1-VL29 (европейская ветвь). К юго-восточной части Балтийского моря ушел субклад L550 (южно-балтийская ветвь), к северо-западной, финской части – субклад CTS9976 и далее L1022. Кстати, надо отметить, что у Г.Н. Гришина, о гаплотипе которого речь шла выше, снипа L1022 в его Y-хромосоме нет. То есть Г. Гришин не относится к финской или скандинавской группе. Собственно, скандинавской группы в отношении гаплогруппы N нет, поскольку миграции, которые продолжались уже в нашей эре с востока на запад, несли с собой или «финские» гаплотипы (с «подписью» 10-10 13-13-14-14, или «славянские», 9-9 14-14-15-15 и их ближайшие производные). В Швеции, например, есть и те, и другие, о чем будет рассказано ниже.
 
Итак, как мы видим, мутации в гаплотипах потомков расходятся от предкового гаплотипа как круги по воде, число мутаций легко рассчитывается, и они подчиняются довольно простым количественным закономерностям. Для кругов на воде, расходящихся от места, куда был брошен камень, легко рассчитать, когда был брошен камень, если знать скорость распространения волны и место нахождения круговой волны в данный момент времени. Чем больше прошло времени – тем дальше круги ушли, тем больше они разошлись. Так и в гаплотипах – чем больше время, прошедшее от общего предка, тем больше мутаций накопилось в гаплотипах его потомков. Число этих мутаций связано со временем, прошедшим от общего предка, с числом гаплотипов в серии, и с константой скорости мутации в гаплотипах, и выражается простой формулой: n/N = kt, где n – число мутаций в серии из N гаплотипов, k – константа скорости мутации (в числе мутаций на гаплотип за условное поколение, равное 25 лет), t – число условных поколений, с табличной поправкой на возвратные мутации. На сотнях и тысячах примеров показано, что эта формула работает при любом числе гаплотипов и мутаций в них, и при любом времени, прошедшем от общего предка рассматриваемых гаплотипов. Однако при очень больших временах, более 10-20 тысяч лет, и особенно более 100 тысяч лет, нужно использовать гаплотипы с «медленными» маркерами, то есть с малыми константами скоростей мутаций, и тем самым снижать число мутаций и число возвратных мутаций. По аналогии, вряд ли целесообразно изучать скорости радиоактивного распада элементов со временами полураспада в тысячелетия, используя секундомер. Или пытаться изучать круги на воде за километры от места, куда был брошен камень, для этого нужно значительно более мощное воздействие. Как всегда, нужен конкретный анализ в конкретной ситуации, единых подходов на все случаи жизни не бывает. Варианты конкретного анализа в конкретных ситуациях и рассматривает ДНК-генеалогия.
 
Мутации в ДНК-генеалогии – это не только единичные необратимые мутации-снипы, описанные выше, которые определяют гаплогруппы и субклады, но и обратимые мутации, меняющие числа повторов, или аллели, в гаплотипах. В русскоязычной литературе их называют просто «мутации», с пониманием, что это не те мутации (в генах), которые обычно возникают под действием радиации. Переход числа повторов в маркере Y-хромосомы от 25 к 24 или 26 (или наоборот) имеет совершенно другую природу, чем «поломка» гена. Такой переход является следствием спонтанной, случайной ошибки ДНК-копирующей «биологической машины», это процесс первого порядка с точки зрения физико-химической или биологической кинетики, он не зависит от внешних воздействий.
 
Что важно отметить – в большинстве случаев результаты расчетов почти не зависят от размера выборки (при числе гаплотипов больше двух-трех десятков), то есть они достаточно устойчивы к статистическим вариациям. Размер выборки увеличивает точность, и то только до определенных пределов. Это относится к довольно большим популяциям, которые перемешались за тысячелетия, но именно с такими обычно и работают.
 
Приведем пример. В таблице ниже даны расчеты времени до общего предка гаплогруппы R1a на постсоветском пространстве. Это, в основном, — Россия, Украина, Белоруссия, Литва, Латвия, Эстония и Казахстан. Видно, что при увеличении выборки от 26 гаплотипов до двух тысяч результаты практически одинаковы в пределах погрешности расчетов. Поэтому когда скептики (а такие есть всегда и везде) повторяют, что несколько десятков или сотен гаплотипов – это ничто для расчетов, им стоит напоминать, что дело не в количестве гаплотипов, а в их перемешанности на рассматриваемой территории. На равнине перемешивание обычно вполне достаточное, в горах – меньше, но и там, как мы видели на примерах карачаево-балкарских и осетинских гаплотипов, данные вполне воспроизводятся по разным выборкам.
 

 
Теперь, когда рамки ДНК-генеалогии обозначены, и ряд иллюстраций из истории гаплогруппы N приведены, перейдем к Рюриковичам, в качестве которых часто рассматривают князей Российской империи. Посмотрим, какие к этому есть основания. А также более внимательно расмотрим вопрос о возможном происхождении князей – как предполагаемых Рюриковичей – от скандинавов.
 
Сразу скажем, что последнее не только маловероятно, но может быть практически исключено. На это указывают данные по гаплогруппе R1a, согласно которым скандинавы имеют характерные мутации в гаплотипах, что и определяет их в субклад R1a-Z284, возраст которого около 5 тысяч лет. На территории России, Украины, Белоруссии этого субклада практически нет. Карта показывает, что в России выявлен всего один носитель скандинавского субклада. В последнее время их найдено еще трое, из нескольких тысяч человек. Другими словами, в России скандинавов практически не было, во всяком случае, на статистически детектируемом уровне, хотя норманисты декларирует, что их на Руси были десятки тысяч или (Л. Клейн) до полумиллиона скандинавов (см. ссылки в работе профессора В.В. Фомина «Клейн как диагноз-2, или дело пустомели Петрея еще живет. Пока», которые якобы и были Русь и управляли ею, от ремесленников и руководителей до высшего состава власти. Ясно, что этого не могло быть, потому что немыслимо, чтобы они не оставили большого (или хотя бы умеренного) количества потомков. Напротив, карта показывает, что пути скандинавов были практически исключительно на запад, на Британские острова. Действительно, там имеется достаточно большое количество носителей скандинавского субклада R1a-Z284, потомков тех скандинавов. Похоже, что те, кого историки (в особенности ангажированные) принимают за «скандинавов» на Руси были на самом деле русскими, славянами, которые вполне могли иметь скандинавские мечи, возводить постройки «скандинавского» типа и привозить из боевых походов скандинавские трофеи.
 
О «шведском происхождении Рюрика» подробно рассказывалось в статье на Переформате два года назад. Там указывалось, что вокруг восточной Прибалтики живут два народа, финны и южные балты, каждый со своим набором гаплотипов и гаплогрупп/субкладов. Надо, впрочем, сказать, что народа «балты» нет, это просто фигура речи, региональное, географическое понятие. Например, до недавнего времени белорусы и литовцы были практически неразделимы, это были славяне. Как, впрочем, и поляки, о славянском отнесении которых никто не спорит. Цитата:
 

 
Если уходить глубже в гаплогруппу N1c1, то у финнов появляется N1c1-CTS9976-L1022, а у южных балтов появляется N1c1-L550. Это означает, что более северный миграционный поток донес свою гаплогруппу N1c1-CTS9976 до территории современной Финляндии, а в более южном потоке и несколько более древнем, южно-балтийском, у кого-то из отцов-основателей проскочила мутация L550, в потомках закрепилась, и именно эти потомки в основном выжили среди южных балтов гаплогруппы N1c1. Вот такая лотерея, в которую природа играет, не переставая. Естественно, к южным балтам могли примкнуть и те, кто сохранил исходную гаплогруппу N1c1, без L550, и тем не менее стал частью южных балтов. А какое-то количество тех, кто получил L550, могли уйти с финнами, или переселиться к ним позже, например, во времена Российской империи, в которую Финляндия входила на протяжении более ста лет (1809-1917), а до того финнами семь веков правили шведы. Переселяются из России в Финляндию и сейчас. Поэтому надо понимать, что ДНК-генеалогические признаки не являются абсолютными (как, впрочем, и любые другие), но они, будучи вероятностными, помогают приходить к определенным выводам, особенно, когда подкрепляются положениями археологии, антропологии, лингвистики, которые, естественно, тоже не являются абсолютными. Так происходит постепенное приближение «к истине», которая тоже не абсолютна, потому что в постоянном приближении. Так работает наука.
 
Князья Российской империи, носители гаплогруппы N, имеют в основном субклад N1c1-L550. Дерево их гаплотипов и соответствующий анализ также были рассмотрены в статье на Переформате два года назад. Было показано, что князей – одиннадцать человек – Гагарин, Кропоткин, Хилков, Пузына, Путятин, Вадбольский, Шаховской, Ржевский, Массальский, Лобанов-Ростовский и Корибут-Воронецкий. Это те, кто прошли тест на 67-маркерные гаплотипы, наиболее чувствительные к вариациям. Базовый, то есть предковый гаплотип для указанных одиннадцати «Рюриковичей» в данном случае определяется надежно. Он – следующий:
 
14 23 14 11 11 13 11 12 10 14 14 16 – 18 9 9 11 12 25 14 19 28 14 14 15 15 – 11 11 18 20 14 15 16 19 34 34 15 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 18 7 13 21 21 16 12 11 10 11 11 12 11
 
Все 11 человек отличаются по своим гаплотипам от приведенного базового на 58 мутаций, что дает 58/11/0.12 = 44 → 46 условных поколений (по 25 лет каждое) назад, или 1150±190 лет от их общего предка. Это – примерно 862±190 год, что не противоречит годам жизни Рюрика (умер в 879 году) или его именитого современника. На самом деле, совпадение здесь практически абсолютное, но не будем на этом фокусироваться, расчетная погрешность не позволяет.
 
Теперь в качестве упражнения рассчитаем, как гаплотипы представителей Дворянского собрания Г.Н. Гришина и С.В. Думина соотносятся с приведенным предковым гаплотипом «Рюриковичей». Мы вынуждены брать этот термин в кавычки, потому что, строго говоря, прямых, документальных подтверждений этому нет, хотя они, как правило, имеют четкую официальную родословную. Более того, как уже упоминалось, есть «Рюриковичи» и в гаплогруппе R1a, с таким же временем жизни общего предка, как и в гаплогруппе N1c1. Снять кавычки было бы научно некорректным, поскольку имеем две пока несовместимых ситуации.
 
Итак, рассмотрим три 67-маркерных гаплотипа – базовый гаплотип «Рюриковичей», и гаплотипы упомянутых представителей Российского Дворянского собрания:
 
14 23 14 11 11 13 11 12 10 14 14 16 – 18 9 9 11 12 25 14 19 28 14 14 15 15 – 11 11 18 20 14 15 16 19 34 34 15 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 18 7 13 21 21 16 12 11 10 11 11 12 11 («Рюрик»)
 
14 23 14 11 11 13 11 13 12 13 14 17 – 17 9 9 11 12 26 14 19 29 15 15 15 15 – 11 10 18 20 14 15 18 19 36 36 14 10 – 11 8 15 17 8 8 10 8 11 10 12 21 22 14 10 12 12 18 7 13 20 21 15 12 11 10 11 11 12 11 (Г.Н. Гришин)
 
14 23 15 11 11 13 11 12 11 13 15 16 – 17 9 9 11 12 25 14 19 27 14 14 15 15 – 11 11 18 20 14 15 16 19 37 37 13 10 – 11 8 15 17 8 8 10 8 11 10 12 21 22 14 10 12 13 18 7 12 22 21 16 12 11 10 11 11 12 11 (С.В. Думин)
 
Между ними попарно 18 и 14 мутаций (Г.Н. Гришин и С.В. Думин от «Рюрика», соответственно), что дает 18/0.12 = 150 → 176 условных поколений, или 4400 лет, и 14/0.12 = 117 → 133 условных поколения, или 3325 лет, соответственно, как сумму временных расстояний от общего предка наших коллег до «Рюрика» и до современных гаплотипов Г.Н Гришина и С.В. Думина. Сам «Рюрик» жил примерно 1150 лет назад, как мы определили выше. Поэтому общий предок «Рюрика» и С.В. Думина жил примерно (3325+1150)/2 = 2240 лет назад, а «Рюрика» и Г.Н. Гришина (4400+1150)/2 = 2775 лет назад.
 
Если подобные расчеты провести между гаплотипами наших коллег и базовым гаплотипом Гедиминовичей
 
14 23 15 11 11 13 11 12 10/11 14 15 16 – 17 9 9 11 12 25 14 19 28 14 14 15 15 – 10 11 18 20 13 14 15 18/19 36 36 14 10 – 11 8 15 17 8 8 10 8 11 10 12 21 22 13 10 12 12 16 7 13 20 21 16 12 11 10 11 11 12 11 («Гедимин»)
 
то разница в мутациях составит уже 21 и 16, соответственно. Таким образом, оба наших коллеги заметно более близки к Рюриковичам, чем к Гедиминовичам. Общий предок Гедиминовичей и С.В. Думина жил примерно 2200 лет назад, общий предок Гедиминовичей и Г.Н. Гришина – примерно 2900 лет назад.
 
Возвращаясь к «Рюриковичам», мы видим, что гаплогруппа N1c1 вписывается по общим предкам «Рюриковичей» в группу князей Российской империи. Но кто такие N1c1? Это что, в самом деле шведы, или финны, или датчане? Да ничего подобного. Давайте разберемся.
 
Как уже упоминалось, гаплогруппа N1c1 разошлась в итоге своей миграции на Балтику на две линии, одна финская и одна южно-балтийская, которая есть славянская, русская (на территории России), или польская, или литовская, или латышская. Напомним, что у них есть два характерных различия. У южных балтов, по сути славян, в гаплотипе есть пара 9-9 и четверка 14-14-15-15. ДНК-генеалог скажет, что это в локусах DYS459a,b и DYS464a,b,c,d, соответственно. Вот они, выделены в предковом гаплотипе русских князей гаплогруппы N1c1:
 
14 23 14 11 11 13 11 12 10 14 14 30 – 18 9 9 11 12 25 14 19 29 14 14 15 15 – 11 11 18 20 14 15 16 19 34 34 14 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 18 7 13 21 21 16 12 11 10 11 11 12 11
 
У финнов там, в основном, 10-10 и 13-13-14-14. Это – очень заметные различия. Давайте отбросим все остальные повторы (так называемые аллели), и построим дерево гаплотипов только для этих двоек и четверок, в совокупности. Для построения дерева 6-маркерных гаплотипов привлечем несколько сотен гаплотипов N1c1 из доступных баз данных. Вот что получилось:
 

Рис. 2. Дерево гаплотипов 425 человек гаплогруппы N1c1, выявленные по базам данных. Гаплотипы составлены из двоек DYS459 и четверок DYS464. Справа по кругу – в основном славяне (базовый гаплотип 9-9 14-14-15-15), слева на удаленной ветви – в основном финны (базовый гаплотип 10-10 13-13-14-14). Гаплотипы справа по кругу (в основном славяне) принадлежат к субкладу N1c1-L550, гаплотипы слева на удаленной ветви (в основном финны) к этому субкладу не относятся. Большинство из 11 русских князей гаплогруппы N1c1 принадлежат правой ветви, в основном славянской. Важность этого положения объясняется выше, на схеме субкладов гаплогруппы N.
 
Итак, слева – финны. Базовая шестерка 10-10, 13-13-14-14. Имена – Korhonen, Pennainen, Mottonen, Hirvonen, Raisanen, Pohjalainen, Nyyssonen, Hakkarainen, Haikonen, Heikkinen, Lehmoinen, Randalainen, Suikkanen, Vihavainen, Kosunen, Vetelainen, Kemilainen, Toivanen, Wayrynen, Komonen, Keskinen, Leppanen, Mikkonen, Kinnunen, Pyykonen, Rahkonen, Parkulain, Kouko, Heikinpoika, Matinpoika, Marponpoika, Fransinpoika и подобные.
 
Справа – в основном славяне, базовая шестерка 9-9, 14-14-15-15. Имена – Селиванов, Козлов, Свистунов, Данилович, Архипов, Муковников, Потураев, Ларионов, Шеховцов, Кулешов, Забелин, Назаров, Никитин, Васильев, Матюшонок, Прокопович и так далее. Здесь в основном русские, украинцы, белорусы, поляки. Здесь же латыши – Аузинс, Ласианис, Витавскис; литовцы – Багдонавичус, Семенас, Довыденас, Андреас, Станкевичус, Сабис, Бартайтис, Грусаускас и подобные имена; поляки – Хилинский, Крузиковский, Новак, Орловский, Крупиенский, Буйновский, Клобуковский, Мосжинский, Пиотровский, Рыкацевский, Жуковский, и так далее. Напомню, что у них всех шестерка аллелей 9-9, 14-14-15-15. Славяне, во всяком случае, по происхождению.
 
Смотрим ещё раз на шестерку аллелей в гаплотипах князей-рюриковичей. Та же шестерка (редко – с одной мутацией, от чего никто не застрахован):
 

Ну, и где там финны? Нет их там. Это – южные балты, славяне. У Гагарина и Пузыны – одноразовые мутации от предкового гаплотипа. У Пузыны одношаговая мутация 14-14-15-15 → 14-14-14-14, так называемая палиндромная, или мультикопийная. Совершенно обычное дело.
 
Посмотрим на норвежские, шведские, эстонские гаплотипы. Среди 425 гаплотипов N1c1 их соответственно 10, 21, 3 гаплотипа, и еще 2 датских. Негусто. Обычно столь малое количество гаплотипов характерно для «туристов», которые еще не успели дать достаточно обильное потомство. И это понятно – носители гаплогруппы N1c1 продвигались с востока на запад, как со стороны финской, так и южно-балтийской. Это в Скандинавии не свои гаплотипы, все – мигранты с востока. Вот и имеем – в Дании оба гаплотипа имеют 9-9, 14-14-15-15, то есть южно-балтийские. Оба – идентичные, то есть их общий предок жил в пределах последних двух столетий. Какие уж там Рюриковичи… Три эстонских гаплотипа – опять южно-балтийские, вовсе не финские. У всех трех четверка 14-14-15-15, нехарактерная для финских гаплотипов, но характерная для славянских. Общий предок жил в начале нашей эры, что обычно для N1c1.
 
Из 10 норвежских гаплотипов четыре – славянские, 9-9, 14-14-15-15, и еще два – продукты одношаговой мутации от них. То есть 60% славянских, южно-балтийских гаплотипов N1c1. Всего один гаплотип – финский, еще два – продукты палиндромных мутаций, которых у Рюриковичей нет. Наконец, у шведов – треть славянских гаплотипов 9-9, 14-14-15-15; еще девять (в сумме – 16, три четверти от всех) – его мутированные производные; и пять гаплотипов (четверть от всех) – финские, 10-10, 13-13-14-14, которых у Рюриковичей нет. Вот такая цена высказываниям историка В. Волкова, что «у рюриковичей – шведские гаплотипы». Нет «шведских гаплотипов» вообще в природе, это – визитеры со стороны славян и со стороны финнов, но гаплотипов последних у Рюриковичей нет. Вот так и получаем ответ: Рюриковичи – либо носители гаплогруппы R1a, славяне, либо носители южно-балтийской, славянской ветви гаплогруппы N1c1.
 
Надо сказать, что когда я упомянул в какой-то дискуссии про арийскую топонимику Русского севера, появился некий «критик», с претензиями на лингвиста, и заявил, что никакой арийской топонимики там нет, это давно уже опровергнуто. На мой вопрос представить ссылки в научной литературе он пообещал это сделать, но пропал бесследно. Цену словам этого «критика» показал другой пример, когда он уверенно объявил, что в шумерском языке есть около двухсот индоевропейских слов. Правда, когда кто-то более знающий объяснил, что эти «индоевропейские слова» являются недоразумениями и подгонками, и в лингвистике давно опровергнуты, наш «критик» тут же сообщил, что он это так сказал, для примера, и нисколько не настаивает. Вот такие «критики».
 
Место действия этого «критика»? Дискуссия на «Троицком варианте». Имя «критика»? При желании, любой может найти, он фигурирует и в трагикомедии о том, как собирали подписи против ДНК-генеалогии в массовке. Вот такие «критики» у ДНК-генеалогии. Но, как говорил вождь, «других критиков у меня для вас нет». Примерно так.
 
Анатолий А. Клёсов,
доктор химических наук, профессор